View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9408_low_2 (Length: 561)
Name: NF9408_low_2
Description: NF9408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9408_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 3e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 207 - 275
Target Start/End: Complemental strand, 15895446 - 15895378
Alignment:
| Q |
207 |
tatgatgagactaattgggagactttgtactttggataatgacaacttaacattgagttcattacactc |
275 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15895446 |
tatgatgagactaattgggagactttgtgctttggataatgacaacttaacattgagttcattacactc |
15895378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 65; Significance: 3e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 207 - 275
Target Start/End: Original strand, 18861359 - 18861427
Alignment:
| Q |
207 |
tatgatgagactaattgggagactttgtactttggataatgacaacttaacattgagttcattacactc |
275 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18861359 |
tatgacgagactaattgggagactttgtactttggataatgacaacttaacattgagttcattacactc |
18861427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University