View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9408_low_28 (Length: 227)
Name: NF9408_low_28
Description: NF9408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9408_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 23935150 - 23934955
Alignment:
| Q |
1 |
agagtgcaaacaaggccattaaaattatggcagataaaaaaccaacaaacatgatggttaagttgtctcttgatatggttgttgtttctaatgtttgtgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
23935150 |
agagtgcaaacaaggccattaaaattaaggcagataaaaaaccaacaaacatgatggttaagttgtctcttgatatggttgttgtttctaatgattgtgc |
23935051 |
T |
|
| Q |
101 |
ttcgatggtgtataaatggaatactaggattacatggaagatcaagtggacccattccatttttcaaacaacaattatcaaactgagatcaatgta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23935050 |
ttcgatggtgtataaatggaatactaggattacatggaagatcaagtggacccattccatttttcaaacaacaattctcaaactgagatcaatgta |
23934955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University