View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9408_low_29 (Length: 218)
Name: NF9408_low_29
Description: NF9408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9408_low_29 |
 |  |
|
| [»] scaffold0291 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 153 - 214
Target Start/End: Complemental strand, 5960892 - 5960828
Alignment:
| Q |
153 |
ttcttcctttctcagatagctttccacct---tcccccattatcatcgaagccacctctccctcc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
5960892 |
ttcttcctttctcagatagctttccaccttcctcccccattatcatcgaagccacctcttcctcc |
5960828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 216
Target Start/End: Complemental strand, 43845791 - 43845725
Alignment:
| Q |
153 |
ttcttcctttctcagatagctttccaccttcc---cccattatcatcgaagccacctctccctccca |
216 |
Q |
| |
|
|||||||||||||| | | ||||||||||||| ||||| |||||||||||||||||||| ||||| |
|
|
| T |
43845791 |
ttcttcctttctcatacaactttccaccttcctcccccataatcatcgaagccacctctccttccca |
43845725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 153 - 214
Target Start/End: Original strand, 6826727 - 6826791
Alignment:
| Q |
153 |
ttcttcctttctcagatagctttccacct---tcccccattatcatcgaagccacctctccctcc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
6826727 |
ttcttcctttctcagatagctttccaccttcctcccccattatcatcgaagccacctcttcctcc |
6826791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 19286 - 19224
Alignment:
| Q |
153 |
ttcttcctttctcagatagctttccaccttcc---cccattatcatcgaagccacctctccct |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19286 |
ttcttcctttctcaggtagctttccaccttcctcccccattatcatcgaagccacctctccct |
19224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 196
Target Start/End: Original strand, 36381257 - 36381302
Alignment:
| Q |
153 |
ttcttcctttctcagatagctttccaccttc--ccccattatcatc |
196 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
36381257 |
ttcttcctttctcatatagctttccaccttcctccccattatcatc |
36381302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University