View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9409_high_3 (Length: 409)
Name: NF9409_high_3
Description: NF9409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9409_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 11 - 144
Target Start/End: Original strand, 32702082 - 32702215
Alignment:
| Q |
11 |
atggacatcacaccttggaatatcagattcaccaacaacaaacaccgaccaatctcagcactctctttcctctcttggtcattctctctgcgtttctacc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32702082 |
atggacatcacaccttggaatatcagattcaccaacaacaaacaccgaccaatctcagcactctctttcctctcttggtcattctctctgcgtttctacc |
32702181 |
T |
 |
| Q |
111 |
tttcctcactctggcgggtaactcacaatcaaaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32702182 |
tttcctcactctggcgggtaactcacaatcaaaa |
32702215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 293 - 409
Target Start/End: Original strand, 32702318 - 32702433
Alignment:
| Q |
293 |
ttgatgctaagaaatttgaccatttttgttgtactgttttggagaaatgttgcagtagaggtttgggtgctgtgagagatcttaagaggggagaaattat |
392 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32702318 |
ttgatgttaagaaatttgaccatttttgttgtattgtattggagaattgt-gcagtagaggtttgggtgctgtgagagatcttaagaggggagaaattat |
32702416 |
T |
 |
| Q |
393 |
tctaagagttccaaaat |
409 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32702417 |
tctaagagttccaaaat |
32702433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University