View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9409_high_6 (Length: 269)
Name: NF9409_high_6
Description: NF9409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9409_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 11 - 259
Target Start/End: Original strand, 47178644 - 47178892
Alignment:
| Q |
11 |
atatccaccctatgatgaatccagcgctccatatcatttccatcttaactactaaatgaaaaatcgcaaaatgctagctgatggcaaagctcaaccattg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47178644 |
atatccaccctatgatgaatccagcgctccatatcatttccatcctaactaataaatgaaaaatcggaaaatgctagctgatggcaaagctcaaccattg |
47178743 |
T |
 |
| Q |
111 |
tggtgttggtggtgatggtggcagtgtcattcatgtgtttttaaactatttgaactgtgtgattgtcctctctatatgcttgttcccacaattgattatg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47178744 |
tggtgttggtggtgatggtggcagtgtcattcatgtgtttttaaactatttgaactgtgtgattgtcctctctatatgcttgtgcccacaattgattatg |
47178843 |
T |
 |
| Q |
211 |
cttttgaattggttggcttgttttttccacacagaactgtttgcctttg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47178844 |
cttttgaattggttggcttgttttttccacacagaactgtttgcctttg |
47178892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 45
Target Start/End: Complemental strand, 47179050 - 47179016
Alignment:
| Q |
11 |
atatccaccctatgatgaatccagcgctccatatc |
45 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47179050 |
atatctaccctatgatgaatccagcgctccatatc |
47179016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University