View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9409_low_18 (Length: 279)
Name: NF9409_low_18
Description: NF9409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9409_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 10306853 - 10307119
Alignment:
| Q |
1 |
gcgctctccctaggtgttgtcacgcctttcactccgactgtattgacaattggctccgttcttccaacctctcatgttgtccgctttgccgttccaccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10306853 |
gcgctctccctaggtgttgtcacgcctttcactccgactgtattgacaattggctccgttcttccaacctctcatgttgtccgctttgccgttccacaat |
10306952 |
T |
|
| Q |
101 |
tttcgcttcagaatccgacctcgcggcgattctccgatcaccttccgacagtttccgagttgaaattggaaatgtgacttatccagaagctgtcggcgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306953 |
tttcgcttcagaatccgacctcgcggcgattctccgatcaccttccgacagtttccgagttgaaattggaaatgtgacttatccagaagctgtcggcgga |
10307052 |
T |
|
| Q |
201 |
gacgcattgtcatcatattccattggaggatcattcgattatcgtgtaatggaggtatcacaggttc |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10307053 |
gacgcattgtcatcatattccattggaggatcattcgattatcgtgtaatggaggtatcgcaggttc |
10307119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 64 - 177
Target Start/End: Original strand, 1722082 - 1722195
Alignment:
| Q |
64 |
ccaacctctcatgttgtccgctttgccgttccaccattttcgcttcagaatccgacctcgcggcgattctccgatcaccttccgacagtttccgagttga |
163 |
Q |
| |
|
|||||||||||||||||| ||| |||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1722082 |
ccaacctctcatgttgtcggctctgccattccaccattttcgcttcagaattcgacctcgccgcgattctccgatcaccttccgacagtttccgagatga |
1722181 |
T |
|
| Q |
164 |
aattggaaatgtga |
177 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1722182 |
aattggaaatgtga |
1722195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University