View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9409_low_30 (Length: 237)
Name: NF9409_low_30
Description: NF9409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9409_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 38 - 222
Target Start/End: Complemental strand, 24952633 - 24952449
Alignment:
| Q |
38 |
ataaagcgcataaaactttgcgaagcaaacgatggnnnnnnnnnnnnnctgtatttggctcaaatatggaatcagattcctgtagtgttatataacaagg |
137 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24952633 |
ataaagtgcataaaactttgcgaagtaaacgatggtttttcactttttctgtatttggctcaaatatggaatcagattcctgtagtgttatataacaagg |
24952534 |
T |
 |
| Q |
138 |
gtttttgagccgccgacacaacatttattgtatactatgcggcagggaagatttgtatatgtaacaaagtagattcagatctctg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
24952533 |
gtttttgagccgccgacacaacatttattgtatactatgcggcagggaagatttatatatgtaacaaggtagattcagatctctg |
24952449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University