View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9410_high_10 (Length: 363)
Name: NF9410_high_10
Description: NF9410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9410_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 18 - 356
Target Start/End: Original strand, 43372832 - 43373170
Alignment:
| Q |
18 |
ttttttaacaatggctctcccctaaacttcctcttcctccatggaagtatgctgcgctttgtactttgtgataaataaggctcagaagaagacgtggtag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43372832 |
ttttttaacaatggctctcccctaaacttcctcttcctccatggaagtatgctgcgctttgtactttgtgataaataaggctcagaagaagacgtggtag |
43372931 |
T |
 |
| Q |
118 |
attcatccatatgcgaacgcccggcatcaggcatgcaatagctgtggtaaacccaaatgtctttctcatcacaattcattctcgtgttggaataataaga |
217 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43372932 |
attcatccatatgcgaacgcccagcatcaggcatgcaatagctgtggtaaacccaaatgtctttctcatcacaattcattctcgtgtttgaataataaga |
43373031 |
T |
 |
| Q |
218 |
acatgatcctccagcatttgcagaggccaatgttccataacggaatgaattcccaacacttgaatcctcattcccccggtctgaatctcctaaatcatcg |
317 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43373032 |
acatgatcctccagcatttgcggaggccaatgttccataacggaatgaattcccaacacttgaatcctcattcccccggtctgaatctcctaaatcatcg |
43373131 |
T |
 |
| Q |
318 |
agtgagtcaaaatctagagagtagttatgagtattatct |
356 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43373132 |
agtgagtcaaaatcgagagagtagttatgagtattatct |
43373170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University