View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9410_high_23 (Length: 208)
Name: NF9410_high_23
Description: NF9410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9410_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 22 - 195
Target Start/End: Complemental strand, 19620279 - 19620099
Alignment:
| Q |
22 |
aaggggaacttgactcttgttctttcttccatgtgcttggaacttgaaatatggagtactaatagtattaaaagaagaaggaacataatgattaaaacca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19620279 |
aaggggaacttgactcttgttctttcttccatgtgcctggaacttgaaagatggagtactagtagtattaaaagaagaaggaacataatgattaaaacca |
19620180 |
T |
 |
| Q |
122 |
ttgatttatgaactctcatgattccaaatgaaaagggaaaagggaa-------aaggagggagctacttaactagtataat |
195 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
19620179 |
tagatttatgaactctcatgattccaaatgaaaagggaaaagggaaaagggaaaaggagggagctacttaactagtttaat |
19620099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University