View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9410_low_22 (Length: 358)
Name: NF9410_low_22
Description: NF9410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9410_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 341
Target Start/End: Complemental strand, 30822435 - 30822095
Alignment:
| Q |
1 |
gtgcatgaaaaattcaaaatctagaagaaatgatgagtctcagctcaactttaaaggctttggttaagcagcgcaagactttacacgtacgtgtttattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30822435 |
gtgcatgaaaaattcaaaatctagaagaaataatgagtcttagctcaactttaaaggctttggttaagcagcgcaagactttacacgtacgtgtttattc |
30822336 |
T |
 |
| Q |
101 |
ttttgttggtgttcnnnnnnnnnngttggtgtacacgtatgtgttttatgaaatagaggagaaatttctcgcaatacatcttcaattttgtgccggaact |
200 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30822335 |
ttttgttggtgttcatttttttttgttggcgtacacgtacgtgttttatgaaatagaggagaaatttctcgcaatacatcttcaattttgtgccggaact |
30822236 |
T |
 |
| Q |
201 |
tcaattcaactctttcttgtacacggtagcttttatctttcttctgcctcataaaacccaagctccgcatcatgcaaatacaccttcgttgtaacttcaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30822235 |
tcaattcaactctttcttgtacacggtagcttttatctttcttctgcctcataaaacccaagctccacatcatgcaaatacaccttcgttgtaacttcaa |
30822136 |
T |
 |
| Q |
301 |
aacttcaaatatcattttctttctactttgtttgaattact |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30822135 |
aacttcaaatatcattttctttctactttgtttgaattact |
30822095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University