View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9410_low_53 (Length: 220)
Name: NF9410_low_53
Description: NF9410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9410_low_53 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 141 - 220
Target Start/End: Complemental strand, 40144415 - 40144336
Alignment:
| Q |
141 |
gataaagttgagcatttatgaaacaggttatgtggaatggagtttcttgaacactcccacctacttgtatttcctttttc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40144415 |
gataaagttgagcatttatgaaacaggttatgtggaatggagtttcttgaacactcccacctacttgtatttcctttttc |
40144336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 40144535 - 40144459
Alignment:
| Q |
1 |
tggttagaactcatattgtggtgacaaagcaaagcacactatagttgcatttgtttgtttaggaaccttatgagttg |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40144535 |
tggttagaactcatattgtggtgacaaagcaaagcacactatagttgcatttgtttgtttaggaaccttatgagttg |
40144459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University