View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9410_low_54 (Length: 209)
Name: NF9410_low_54
Description: NF9410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9410_low_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 15 - 169
Target Start/End: Original strand, 33266370 - 33266520
Alignment:
| Q |
15 |
ggacatctatattgaatgaaaatttaattacacttaaccttgtaaatgtcaaatccacttgcaaaccaccaagctaacaaggaaatcagacgatacttgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33266370 |
ggacatctatattgaatgaaaatttaattacacttaaccttgtaaatgtcaaatccacttgcaaaccaccaagctaacaaggaaatcagatgatacttgg |
33266469 |
T |
|
| Q |
115 |
aaagtattagcagtcaaccgcaaaacc--agaagtaggaagagatcatgcaccacca |
169 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
33266470 |
aaagtattagcag------gcaaaaccagagaagtaggaagggatcatgcaccacca |
33266520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 16 - 102
Target Start/End: Original strand, 33261771 - 33261857
Alignment:
| Q |
16 |
gacatctatattgaatgaaaatttaattacacttaaccttgtaaatgtcaaatccacttgcaaaccaccaagctaacaaggaaatca |
102 |
Q |
| |
|
||||||||| |||||| ||| |||||| | |||||||||| ||||||||||||| ||||||||| |||||||||||||| ||||||| |
|
|
| T |
33261771 |
gacatctattttgaattaaactttaatcatacttaaccttataaatgtcaaatctacttgcaaatcaccaagctaacaaagaaatca |
33261857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University