View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9410_low_56 (Length: 208)

Name: NF9410_low_56
Description: NF9410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9410_low_56
NF9410_low_56
[»] chr6 (1 HSPs)
chr6 (22-195)||(19620099-19620279)


Alignment Details
Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 22 - 195
Target Start/End: Complemental strand, 19620279 - 19620099
Alignment:
22 aaggggaacttgactcttgttctttcttccatgtgcttggaacttgaaatatggagtactaatagtattaaaagaagaaggaacataatgattaaaacca 121  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||    
19620279 aaggggaacttgactcttgttctttcttccatgtgcctggaacttgaaagatggagtactagtagtattaaaagaagaaggaacataatgattaaaacca 19620180  T
122 ttgatttatgaactctcatgattccaaatgaaaagggaaaagggaa-------aaggagggagctacttaactagtataat 195  Q
    | ||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||| ||||    
19620179 tagatttatgaactctcatgattccaaatgaaaagggaaaagggaaaagggaaaaggagggagctacttaactagtttaat 19620099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University