View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9411_high_7 (Length: 228)
Name: NF9411_high_7
Description: NF9411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9411_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 10 - 211
Target Start/End: Complemental strand, 40667371 - 40667170
Alignment:
| Q |
10 |
agaagcaaaggaatttggataacttttacaagagatgatagactgctcaatgtcttgcatgctatgacagtctgataatgatacaaacttggacaaagaa |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40667371 |
agaagctaaggaatttggataacttttacaagagatgatagactgctcaatgtcttgcatgctatgacaatctgataatgatacaaacttggacaaagaa |
40667272 |
T |
|
| Q |
110 |
tacacaggttttgtttctgcaattttgtcatgtgcattttgagatctccatatatccacagacaagtcatctttaaccaatgctacattacatggtatct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40667271 |
tacacaggttttgtttctgcaattttgtcatgtgcattttgagatctccatatatccacagacaagtcatctttaaccaatgctacattacatggtatct |
40667172 |
T |
|
| Q |
210 |
tg |
211 |
Q |
| |
|
|| |
|
|
| T |
40667171 |
tg |
40667170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University