View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9411_low_13 (Length: 328)
Name: NF9411_low_13
Description: NF9411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9411_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 294
Target Start/End: Complemental strand, 39933966 - 39933690
Alignment:
| Q |
18 |
aatagaacgtgtggttgttggaaataagagagaagtcactatgacaagactgaacagagcagagcacaagcgaggccacataaacccagagagataagaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39933966 |
aatagaacgtgtggttgttggaaataagagagaagtcactatgacaagactgaacagagcagagcacaagcgaggccacataaacccagagagataagaa |
39933867 |
T |
|
| Q |
118 |
gatgtttctctacgaataatgtcaagctaaacgacaaaatacttttttgacgcgttgctttcatttctccttttttactagattaattttgttgcacact |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39933866 |
gatgtttctctacgaataatgtcaagctaaacgacaaaatacttttttgacgctttgctttcatttctccttttttactagattaattttgttgcacact |
39933767 |
T |
|
| Q |
218 |
ttataccaaggtaattaaaatggaaccgatcgattcgagtagttggatcgggagccggacctgggtccacttcaaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39933766 |
ttataccaaggtaattaaaatggaaccgatcgattcgagtagttggatcgggagctggacctgggtccacttcaaat |
39933690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University