View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9411_low_29 (Length: 204)
Name: NF9411_low_29
Description: NF9411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9411_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 19 - 183
Target Start/End: Complemental strand, 18794877 - 18794712
Alignment:
| Q |
19 |
gtagttggttatcaagttagttactatcctatatgatgtaacacata----gtagcttatagtacaccactatagaactactataaattcttgtaacagc |
114 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18794877 |
gtagtcggttatgaagttagttactatcctatatgatgtaacacatatatagtagcttatagtacaccactatagaactactataaattcttgtaacagc |
18794778 |
T |
|
| Q |
115 |
tttactttgataataattcaatattttctctcattttctcttattttctatcactttctatcatgttct |
183 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18794777 |
tttactttga---taattcaatattttctctcattttctcttattttctatcactttctatcatgttct |
18794712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 169
Target Start/End: Complemental strand, 5613 - 5575
Alignment:
| Q |
131 |
ttcaatattttctctcattttctcttattttctatcact |
169 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5613 |
ttcaatattttctctcattttctctggttttctatcact |
5575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University