View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9412_high_1 (Length: 431)
Name: NF9412_high_1
Description: NF9412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9412_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 2e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 7 - 216
Target Start/End: Original strand, 35163077 - 35163278
Alignment:
| Q |
7 |
tagattatactcattactcatatttaacatgtgacaaattctttaccaagccaaattatttaaaccttgtgtctctaaatctaaataaaacaggaaaaac |
106 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163077 |
tagattatactcatcactcatatttaacatgtgacaaattctttaccta-----attatttaaaccttgtgtctctaaatctaaataaaacaggaaaaac |
35163171 |
T |
 |
| Q |
107 |
taatttatcaactcctactttgtctcttctaaaataatttcaatcccacttcacaggtggtaaacaaagaacaaccgccaaataattcacttaactaccg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163172 |
taatttatcaactcctactttgtctcttctaaaataatttcaatcccacttcaca---ggtaaacaaagaacaaccgccaaataattcacttaactacca |
35163268 |
T |
 |
| Q |
207 |
gttgattgat |
216 |
Q |
| |
|
|||||||||| |
|
|
| T |
35163269 |
gttgattgat |
35163278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 326 - 412
Target Start/End: Original strand, 35163385 - 35163471
Alignment:
| Q |
326 |
ctggacgccgtccacccttataaatactagacactcccaccttcttttctcatcccacctcactctacacttgccaattcaagacac |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163385 |
ctggacgccgtccacccttataaatactagacactcccaccttcttttctcatcccacctcactctacacttgccaattcaagacac |
35163471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University