View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9412_low_14 (Length: 264)
Name: NF9412_low_14
Description: NF9412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9412_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 170
Target Start/End: Complemental strand, 41014842 - 41014690
Alignment:
| Q |
18 |
cagagactgtaaacagaaactcatgatcaaaaaaccatctacaggatatacacagctagcaactagaatagtaatattttgtgtacggattgcataggat |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41014842 |
cagagactgtaaacagaaattcatgatcaaaaaaccatttacaggatatacacagctagcaactagaatagtaatattttgtgtacggattgcataggat |
41014743 |
T |
|
| Q |
118 |
gccatattgccatacaaaatgttaggcttattttgagtgcatgcaccattaac |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41014742 |
gccatattgccatacaaaatgttaggcttattttgagtgcatgcaccattaac |
41014690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 194 - 254
Target Start/End: Complemental strand, 41014703 - 41014641
Alignment:
| Q |
194 |
catgcaccattaactag--tgagtagtatttgtaacttttaattaactgtaatgtatatttgt |
254 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41014703 |
catgcaccattaactagagtgagtagtatttgtaacttttaattaactgtaatgtatatttgt |
41014641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University