View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9412_low_20 (Length: 251)
Name: NF9412_low_20
Description: NF9412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9412_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 30963925 - 30963699
Alignment:
| Q |
1 |
agcgattattagtgtcttagactcttactatgcaatttatatgtctcagctttcaaaatcttccaccatgccgaacttgaagaagctactaaccattttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30963925 |
agcgattattagtgtcttagactcttactctgcaatttatatgtctcagctttcaaaatcttccaccatgccgaacttgaagaagctactaaccattttg |
30963826 |
T |
 |
| Q |
101 |
acacttttctgggatctggagggttcggcagagtctattatggtaagaagctgcaaagatatctgcaaagtttaatgagaaaatgatgattgcactcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30963825 |
acacttttctgggatctggagggttcggcagagtctattatggtaagaagctgcaaagatatctgcaaagtttaatgagaaaatgatgattgcactcttt |
30963726 |
T |
 |
| Q |
201 |
aattgtagttcaataccttggtgtttt |
227 |
Q |
| |
|
|| |||||||||||||||||||||||| |
|
|
| T |
30963725 |
aactgtagttcaataccttggtgtttt |
30963699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 4 - 215
Target Start/End: Complemental strand, 30933545 - 30933334
Alignment:
| Q |
4 |
gattattagtgtcttagactcttactatgcaatttatatgtctcagctttcaaaatcttccaccatgccgaacttgaagaagctactaaccattttgaca |
103 |
Q |
| |
|
|||||||| ||| |||||||||||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
30933545 |
gattattaatgttttagactcttactatgtaattcatacgtctcagctttcaaaatcttccaccatgccgaacttgaagaagctactaacaagtttgaca |
30933446 |
T |
 |
| Q |
104 |
cttttctgggatctggagggttcggcagagtctattatggtaagaagctgcaaagatatctgcaaagtttaatgagaaaatgatgattgcactctttaat |
203 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
30933445 |
cttttttgggatctggagggttcggcagagtctactatggtaagaagctgcaaaggtatctgcaaattttaatgacaaaatgatgactgcactctttaat |
30933346 |
T |
 |
| Q |
204 |
tgtagttcaata |
215 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30933345 |
tgtagttcaata |
30933334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University