View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9412_low_31 (Length: 224)
Name: NF9412_low_31
Description: NF9412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9412_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 18805936 - 18806112
Alignment:
| Q |
1 |
tgcccgttggtttaggaagtttcatgagaaaccttagagagggagcttgatgcatgtcattgtgatcatcaataatattatacgagcttggtcgttaatc |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18805936 |
tgcccgttggtttaggaagtttcttgagaaaccttagagagggagcttgatgtatgtcattgtgatcaccaataatattatacgagcttggtcgttaatc |
18806035 |
T |
 |
| Q |
101 |
aagagcaactttaatctttaattggttttcttaatcaacacttatctaaatattgtatggtataaattatacggtat |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18806036 |
aagagcaactttaatctttaattggttttcttaatcaacacttatctaaatattgtatggtataaattataccgtat |
18806112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 4598542 - 4598411
Alignment:
| Q |
1 |
tgcccgttggtttaggaagtttcatgagaaaccttagagagggagcttgatgcatgtcattgtgatcatcaataatattatacgagcttggtcgttaatc |
100 |
Q |
| |
|
|||||||||||||||||| |||| ||| |||||| ||| |||||||||| |||| || ||| || |||||| | ||| ||| |||||| |||||| |
|
|
| T |
4598542 |
tgcccgttggtttaggaaatttcttgaaaaacctcagaattagagcttgatgtatgtaatcatgaccaccaataaaacaatatgagtttggtcattaatc |
4598443 |
T |
 |
| Q |
101 |
aagagcaactttaatctttaattggttttctt |
132 |
Q |
| |
|
||||| |||| ||||||| |||||||||||| |
|
|
| T |
4598442 |
aagagaaactataatcttgcattggttttctt |
4598411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University