View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9412_low_33 (Length: 208)
Name: NF9412_low_33
Description: NF9412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9412_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 192
Target Start/End: Complemental strand, 4408599 - 4408422
Alignment:
| Q |
15 |
taatactgcggtcttacaaaaataactagcttgaaacttattaacagttaattaaatgtaactaatctccttgatctctaataaaacatattagtgtatc |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4408599 |
taatattgcggtcttacaaaaataactagcttgaaacttattaacagttaattaaatgtaactaatctccttgatctctaataaaacatattagtgcatc |
4408500 |
T |
 |
| Q |
115 |
cacaaaagtgcgcttcatataggaacttgtttggtgagaataaaagagtcgttgtgaattaaaacttatattagttga |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4408499 |
cacaaaagtgcgcttcatataggaacttgtttggtgagaataaaagagtcgttgtgaattaaaacttatattagttga |
4408422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University