View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9414_high_1 (Length: 282)
Name: NF9414_high_1
Description: NF9414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9414_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 10 - 261
Target Start/End: Original strand, 21283055 - 21283306
Alignment:
| Q |
10 |
ataattctctttctggtcctcttccatcttcacttacttcacttacatctcttgtccattgtgatctttcttctaattttctcaacggctcgttacctga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21283055 |
ataattctctttctggtcctcttccatcttcactcacttcacttacatctcttgttcattttgatctttcttctaattttctcaacggctcgttacctga |
21283154 |
T |
 |
| Q |
110 |
gtcgttgagtgaattaatatctttaacaggtactttgaatctttctcataatagtttctccggtcagataccggagaaactggggaatcttcctatagag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21283155 |
gtcgttgagtgaattaatatctttaacaggtactttgaatctttctcataatagtttctccggtcagataccggagaaactggggaatcttcctgtagag |
21283254 |
T |
 |
| Q |
210 |
gttagtttggatcttcgtgataatatgcttagtggggagattcctcaggtgg |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21283255 |
gttagtttggatcttcgtgataatatgcttagtggggagattcctcaggtgg |
21283306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University