View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9415_low_10 (Length: 318)
Name: NF9415_low_10
Description: NF9415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9415_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 8628382 - 8628529
Alignment:
| Q |
1 |
atacttgaattagtatgcttttagtggtaaccagattatgaagaaacttttctttcttagatatgcaagttatgatgtttccacgaactccacacatggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8628382 |
atacttgaattagtatgcttttagtggtaaccagattatgaagaaacttttctttcttagaaatgcaagttatgatgtttccacaaactccacacatggt |
8628481 |
T |
 |
| Q |
101 |
tcacagcaaaaatattgtattgtgacaatgatattaatgacttgctat |
148 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8628482 |
tcacaacaaaaatattgtattgtgacaatgatattaatgacttgctat |
8628529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 230 - 306
Target Start/End: Original strand, 8628565 - 8628641
Alignment:
| Q |
230 |
atcttttacacaatcgaatcaacacaaaacataaaacatagtgtatgaaattttatggttaaccatagtagtataat |
306 |
Q |
| |
|
||||| |||||||||||||||| | |||||| | ||| ||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
8628565 |
atcttctacacaatcgaatcaatataaaacacacaacgtagtgtatgaaattttatggttaaccataataatataat |
8628641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University