View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9415_low_12 (Length: 298)
Name: NF9415_low_12
Description: NF9415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9415_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 14 - 266
Target Start/End: Complemental strand, 18001395 - 18001143
Alignment:
| Q |
14 |
attgtgaaatttcgacttaattattatgattttgattaggatatgtaacttggggtttgcagttgacaatggttgattttctaaatgaaataaaaacaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18001395 |
attgtgaaatttcgacttaattattatgattttgattaggatatgtaacttggggtttgcagttgacaatggttgattttctaaatgaaataaaaacaga |
18001296 |
T |
|
| Q |
114 |
taacaagtcatgttggatttcgttatcttttactacttgataactagatccaatttctaaaattgcttacttagtttcacgacgtttaaataaaatagat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18001295 |
taacaagtcatgttggatttcgttatcttttactacttggtaactagatccaatgtctacaattgcttacttagttttacgacgtttaaataaaatagat |
18001196 |
T |
|
| Q |
214 |
aggtcaatatcatggtgcttaactctcttcttcggttacaaaattctttattt |
266 |
Q |
| |
|
| ||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
18001195 |
aagtcaatatcatggtgcttaacactcttcttcgattacaaaattctttattt |
18001143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 251 - 279
Target Start/End: Complemental strand, 18001107 - 18001079
Alignment:
| Q |
251 |
acaaaattctttattttattctggcaatg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18001107 |
acaaaattctttattttattctggcaatg |
18001079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University