View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9416_high_4 (Length: 297)
Name: NF9416_high_4
Description: NF9416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9416_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 16919701 - 16919976
Alignment:
| Q |
1 |
aaagaaaaggtgaaaaatcgtttcctccgaaaccatgcaaagactgcaaactgaaggcaaatggcatcctctatcttttaggttctcatcaactgggatt |
100 |
Q |
| |
|
|||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16919701 |
aaagaataggtgaaaagccgtttcctcagaaaccatgcaaagactgcaaactgaaggcaaatgacatcctctatcttttaggttctcatcaactgggatt |
16919800 |
T |
|
| Q |
101 |
ttatcgttcattaatctccatgcaagcagagattttgatagggggaatgtttggagaccaaatagttttggcccattgaatagactgggaaggggtgtct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16919801 |
ttatcgttcattaatctccatgcaagcagagattttgat-gggggaatgtttggagaccagatagttttggcccattgaatagactgggaaggggtgtct |
16919899 |
T |
|
| Q |
201 |
ttaaacttataagcatccttaaaagataaactaccatttgttgtatgtgtccaaaccagatcatcttctatctcctg |
277 |
Q |
| |
|
||||||| ||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16919900 |
ttaaactcataagcatccttaaaagataagcttccatttgttgtatgtgtccaaaccagatcatcttctatctcctg |
16919976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University