View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9416_high_6 (Length: 202)

Name: NF9416_high_6
Description: NF9416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9416_high_6
NF9416_high_6
[»] chr3 (3 HSPs)
chr3 (119-191)||(38793289-38793361)
chr3 (16-59)||(38793421-38793464)
chr3 (119-187)||(46495923-46495989)
[»] chr1 (1 HSPs)
chr1 (16-52)||(13876189-13876225)


Alignment Details
Target: chr3 (Bit Score: 73; Significance: 1e-33; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 119 - 191
Target Start/End: Complemental strand, 38793361 - 38793289
Alignment:
119 gttttgagtttttaaaatgcgttgtgtttgttagtactttggaagctccggagtgtgagaatgttgttactga 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38793361 gttttgagtttttaaaatgcgttgtgtttgttagtactttggaagctccggagtgtgagaatgttgttactga 38793289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 16 - 59
Target Start/End: Complemental strand, 38793464 - 38793421
Alignment:
16 gagagcaacgcaattggatccggtaagagaagccattgctgttt 59  Q
    |||||| |||||||||||||||||||||||||||||||||||||    
38793464 gagagcgacgcaattggatccggtaagagaagccattgctgttt 38793421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 187
Target Start/End: Complemental strand, 46495989 - 46495923
Alignment:
119 gttttgagtttttaaaatgcgttgtgtttgttagtactttggaagctccggagtgtgagaatgttgtta 187  Q
    ||||||||||||||||||| |  ||||| |||||| ||||||||||||| || |||||||| |||||||    
46495989 gttttgagtttttaaaatgtg--gtgttggttagtgctttggaagctccagattgtgagaaagttgtta 46495923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 13876189 - 13876225
Alignment:
16 gagagcaacgcaattggatccggtaagagaagccatt 52  Q
    ||||||| ||||||||||||||||||||||| |||||    
13876189 gagagcagcgcaattggatccggtaagagaaaccatt 13876225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University