View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9416_low_16 (Length: 338)
Name: NF9416_low_16
Description: NF9416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9416_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 2 - 324
Target Start/End: Complemental strand, 26867982 - 26867660
Alignment:
| Q |
2 |
ttattctcattggcaattttttctctttcacgatacaatttttattttagttgaaaattgttctttaggctctcttgatctgctctcgggcaaataccta |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26867982 |
ttattctcattggcaattttttctctttcacgatacaatttttattttagttgaaaattgttctttaggctctcttgatttgctctcgggcaaataccta |
26867883 |
T |
|
| Q |
102 |
caatggtagttaattttcgttcactgatatacgacagttaattgttgttgtcaagaaccataattaactctcagttacaaataaaaacttattgtgtgaa |
201 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26867882 |
caatggtagataattttcgttcactgatatacgacaattaattgttgttgtcaagaaccataattaactctcagttacaaataaaaacttattgtgtgaa |
26867783 |
T |
|
| Q |
202 |
attggaatgcacaatcagacataacggttcgtctatacacacatgtcagacacataattcaacatgcattagtttattcagacacatctatcgttcctaa |
301 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26867782 |
attggaatgcacaatcaggcataacggttcgtctatacacacatgtcagacacataattcaacatgcattaatttattcagacacatctatcgttcctaa |
26867683 |
T |
|
| Q |
302 |
ttcgacaacgctacattataatt |
324 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26867682 |
ttcgacaacgctacattataatt |
26867660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University