View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9416_low_28 (Length: 280)
Name: NF9416_low_28
Description: NF9416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9416_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 1975320 - 1975581
Alignment:
| Q |
1 |
actgtttatagggaatacaagaagaaatgaaaacaagaaaaaacctacttaggcaagcatttcctgtggtaagctttagggcagcgtctacacattgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1975320 |
actgtttatagggaatacaagaagaaatgaaaacaagaaaaaacctacttaggcaagcatttcctgtggtaagctttagggcagcgtctacacattgcaa |
1975419 |
T |
|
| Q |
101 |
attgcagatcatgaacatttctattttcaccttttctgcataaagaacatatatgaagaggacagacaaatgttttttcgatgataatgcgctttctcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1975420 |
attgcagatcatgaacatttctattttcaccttttctgcataaagaacatatatgaagaggacagacaaatgttttttcgatgataatgcgctttctcat |
1975519 |
T |
|
| Q |
201 |
ttcctcttgtccaatgtcaatgccagggtagagtagtcttgcaacacattcagggtggtaat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1975520 |
ttcctcttgtccaatgtcaatgccagggtagagtagtcttgcaacacattcagggtggtaat |
1975581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University