View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9416_low_30 (Length: 274)
Name: NF9416_low_30
Description: NF9416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9416_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 14 - 255
Target Start/End: Complemental strand, 35400559 - 35400318
Alignment:
| Q |
14 |
taggcattttcgacctcacatattgtctaaccgtacttccacgcccttttccttcttcactagaattattattgctactcaaattcccttcttgtgatga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35400559 |
taggcattttcgacctcacatattgtctaaccgtacttccacgcccttttccttcttcactagaattattattgctactcaaattcccttcttgtgatga |
35400460 |
T |
|
| Q |
114 |
tatctcattgttacttatttcaccacaaggaccttcacttatcactatcacatgatcatctccatcatccacggcatcttcgtttaaatcgaagaacgaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35400459 |
tatctcattgttacttatttcaccacaaggaccttcacttatcactatcacatgatcatctccatcatccacggcatcttcgtttaaatcgaagaacgaa |
35400360 |
T |
|
| Q |
214 |
cgttttcttcgaatcggcaaagaggcatgtttagctccgatt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35400359 |
cgttttcttcgaatcggcaaagaggcatgtttagctctgatt |
35400318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University