View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9416_low_31 (Length: 266)
Name: NF9416_low_31
Description: NF9416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9416_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 55572802 - 55573040
Alignment:
| Q |
18 |
gaaactccccttcattttgtttctattttctttatacaatgaaatttcatcatccttttacgttcctttctgtctctctagttgttatgtgctgtaatgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55572802 |
gaaactccccttcattttgtttctattttctttatacaatgaaatttcatcatccttttacgttcctttctgtctctctagttgttatgtgctgtaatgg |
55572901 |
T |
|
| Q |
118 |
tttttatctttcacaactttgatgaaccaagtgtcataaattgcatgacatggttccataaatataaaaaggtcttgtttgaattcataaatgaatcatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55572902 |
tttttatctttcacaactttgatgaaccaagtgtcataaattgcatgacatggttccataaagataaaaaggtcttgtttgaattcataaatgaatcatt |
55573001 |
T |
|
| Q |
218 |
ttgatacatgcttttcaattttcatcgttggagcctatg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55573002 |
ttgatacatgcttttcaattttcatcgttggagcctatg |
55573040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 183 - 256
Target Start/End: Original strand, 33035433 - 33035506
Alignment:
| Q |
183 |
aaaaaggtcttgtttgaattcataaatgaatcattttgatacatgcttttcaattttcatcgttggagcctatg |
256 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||| |
|
|
| T |
33035433 |
aaaagggtcttgtttgaattcataaatgaatcattttgatacatgctcttcaattttggtcgtaggagcctatg |
33035506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 183 - 239
Target Start/End: Original strand, 12080703 - 12080759
Alignment:
| Q |
183 |
aaaaaggtcttgtttgaattcataaatgaatcattttgatacatgcttttcaatttt |
239 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
12080703 |
aaaagggtcttttttgaattcataaatgaatcatcttgatacatgctcttcaatttt |
12080759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University