View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9416_low_35 (Length: 230)
Name: NF9416_low_35
Description: NF9416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9416_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 6 - 144
Target Start/End: Complemental strand, 29501045 - 29500907
Alignment:
| Q |
6 |
attcatcagttaacaaaccataaaactcgcgaataacccttctattctaaaaatccaaatcaaattccacttgcgaatcattcattgggaacttcaattg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29501045 |
attcatcagttaacaaaccataaaactcgcgaataacccttctattctaaaaatccaaatcaaattccacttgcgaatcattcattgggaacttcaattc |
29500946 |
T |
 |
| Q |
106 |
agttgattattttctgtttggtgaaggattcacagttac |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29500945 |
agttgattattttctgtttggtgaaggattcacagttac |
29500907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University