View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9416_low_41 (Length: 202)
Name: NF9416_low_41
Description: NF9416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9416_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 1e-33; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 119 - 191
Target Start/End: Complemental strand, 38793361 - 38793289
Alignment:
| Q |
119 |
gttttgagtttttaaaatgcgttgtgtttgttagtactttggaagctccggagtgtgagaatgttgttactga |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38793361 |
gttttgagtttttaaaatgcgttgtgtttgttagtactttggaagctccggagtgtgagaatgttgttactga |
38793289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 16 - 59
Target Start/End: Complemental strand, 38793464 - 38793421
Alignment:
| Q |
16 |
gagagcaacgcaattggatccggtaagagaagccattgctgttt |
59 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38793464 |
gagagcgacgcaattggatccggtaagagaagccattgctgttt |
38793421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 187
Target Start/End: Complemental strand, 46495989 - 46495923
Alignment:
| Q |
119 |
gttttgagtttttaaaatgcgttgtgtttgttagtactttggaagctccggagtgtgagaatgttgtta |
187 |
Q |
| |
|
||||||||||||||||||| | ||||| |||||| ||||||||||||| || |||||||| ||||||| |
|
|
| T |
46495989 |
gttttgagtttttaaaatgtg--gtgttggttagtgctttggaagctccagattgtgagaaagttgtta |
46495923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 13876189 - 13876225
Alignment:
| Q |
16 |
gagagcaacgcaattggatccggtaagagaagccatt |
52 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
13876189 |
gagagcagcgcaattggatccggtaagagaaaccatt |
13876225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University