View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9417_high_4 (Length: 252)
Name: NF9417_high_4
Description: NF9417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9417_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 10 - 236
Target Start/End: Original strand, 42520287 - 42520513
Alignment:
| Q |
10 |
gcaaaggaaaagggaaaaattgatgtaaattgcatagcaaaaaggaaaataggaatgtttcacgtaccagatagaaagagcatgtgcataaacaaaacta |
109 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
42520287 |
gcaaaggaaaaggtaaaaattgatgtaaattgcatagcaaaaaggaaaataggaatgttttacgtaccagagagaaagagcatgcgcataaacaaaacta |
42520386 |
T |
 |
| Q |
110 |
cgatgaaacaagtgaaggtttgagctaagtccactattatataatatttcagtttgttatannnnnnnattttatttaaacaaacctgtctatctttgta |
209 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
42520387 |
cgatgaaacaagtgaaggtttgagctgagtccactattatataatatttcagtttgttatatttttttattttatttaaacaaacctgtctatcttttta |
42520486 |
T |
 |
| Q |
210 |
taaaataataatttcgtatccatagct |
236 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42520487 |
taaaataataatttcgtatccatagct |
42520513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University