View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9417_low_17 (Length: 244)
Name: NF9417_low_17
Description: NF9417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9417_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 12 - 227
Target Start/End: Complemental strand, 38999619 - 38999404
Alignment:
| Q |
12 |
caaagggtgcaggaattggataaattaatggttcaacattgatgaacagacatacaaggcaaaaacattgattagaatggattcattcaatcagagtcat |
111 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38999619 |
caaagggtgcaggaattggataatttaatggttcaacattgatgaacagacattcaaggcaaaaacattgattagaatggattcattcaatcagagtcat |
38999520 |
T |
|
| Q |
112 |
caaaacaacaactttaggtacaatccaaatttgaatagagctacccaattagatgatgaagatgaagcagagttcacaggtcttcttgatgtctatgttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38999519 |
caaaacaacaactttaggtacaatccaaatttgaatagagctacccaattagatgatgaagatgaagcagagttcacaggtcttcttgatgtctatgttc |
38999420 |
T |
|
| Q |
212 |
atcatgctagaaacat |
227 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38999419 |
atcatgctagaaacat |
38999404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University