View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9417_low_19 (Length: 216)
Name: NF9417_low_19
Description: NF9417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9417_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 50 - 204
Target Start/End: Original strand, 14643914 - 14644068
Alignment:
| Q |
50 |
ggaataatgtggtgactgatccaaatcatctttattgttaannnnnnnngtcattaaaaactcgaaaaacaactttccctattatatttgatgcatagcg |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14643914 |
ggaataatgtggtgactgatccaaatcatctttattgttaattttttttgtcattaacaactcgaaaaacaactttccctattatatttaatgcatagcg |
14644013 |
T |
 |
| Q |
150 |
atcgacattacaacctcaaagagggaacataaatagtttagttactttccctttg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14644014 |
atcgacattacaacctcaaagagggaacataaatagtttagttactttccctttg |
14644068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University