View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9417_low_5 (Length: 354)
Name: NF9417_low_5
Description: NF9417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9417_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 147 - 337
Target Start/End: Complemental strand, 7307867 - 7307677
Alignment:
| Q |
147 |
actctgtattgtttcgggtatttggttgcagcaggttctgtattgtgtttctaccaggttcttttttctttctttctgggatctgtggtacaggtcttat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7307867 |
actctgtattgtttcgggtatttggttgcagcaggttctgtattgtgtttctaccaggttcttttttcattctttctgggatctgtggtacaggtcttat |
7307768 |
T |
 |
| Q |
247 |
gagggaggaccttcagtgtttgctgtggagttcacagtctggtgtaaggtttgatgtgggtgcctcaggttctgttttcagcataacccct |
337 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7307767 |
gagggaggacattcagtgtttgctgtggagttcacagtctggtgtaaggtttgatgtgggtgcctcaggttctgttttcagcataacccct |
7307677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 7308013 - 7307924
Alignment:
| Q |
1 |
tcaagcttttattgtagacatggtggttgagtaaatcgtagttgtctcattgcctctattatgaatggtgttgggatccttgtatgtgta |
90 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7308013 |
tcaagcttttattgtagaaatggtgattgagtaaatcgaagttgtctcattgcctctgttatgaatggtgttgggatccttgtatgtgta |
7307924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University