View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9417_low_6 (Length: 343)
Name: NF9417_low_6
Description: NF9417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9417_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 1 - 333
Target Start/End: Original strand, 42867396 - 42867729
Alignment:
| Q |
1 |
cctagtttctttcgactacgaaacaataattcatatgcaagata-gnnnnnnngtagttcttctgtgatcatgtccctctagaagtggacacgtgtggaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42867396 |
cctagtttctttcgactacgaaacaataattcatatgcaagataagtttttttgtagttcttctgtgatcatgtccctctagaagtggacacgtgtggaa |
42867495 |
T |
 |
| Q |
100 |
atgctatgcatacatattctttttcactctagaagtggacagaaattttgttttatctttttctgaatttaatggttatttcttgacccaattttgttgc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42867496 |
atgctatgcatacatattctttttcactctagaagtggacagaaattttgttttatctttttctgaatttaatggttatttcttgacccaattttgttgc |
42867595 |
T |
 |
| Q |
200 |
tgcctttctttgttttttgatgcacagcggtatcatgcttacttcatggaggagatcgactcatggatgattatatctgcaggttcacttctctttttat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42867596 |
tgcctttctttgttttttgatgcacagcggtatcatgcttacttcatggaggagatcgactcatggatgattatatctgcaggttcacttctctttttat |
42867695 |
T |
 |
| Q |
300 |
tgaggatcttgtacatatgtttcagcttcctatg |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42867696 |
tgaggatcttgtacatatgtttcagcttcctatg |
42867729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University