View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9418_high_9 (Length: 208)

Name: NF9418_high_9
Description: NF9418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9418_high_9
NF9418_high_9
[»] chr4 (1 HSPs)
chr4 (6-192)||(52511011-52511196)


Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 6 - 192
Target Start/End: Complemental strand, 52511196 - 52511011
Alignment:
6 agaagcagagaacaaaatgagcttaaactgaagatggtccacatatagtgagttagtgacagacagacacaaacaatgagaatactattactgtttatgg 105  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52511196 agaagcaaagaacaaaatgagcttaaactgaagatggtccacatatagtgagttagtgacagacagacacaaacaatgagaatactattactgtttatgg 52511097  T
106 aggattgtttttgttgtaaaggacaagagccaaaaacatatatgtcttctcattggcagagttttagaaatttccgtgtgaaaaggt 192  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||    
52511096 aggattgtttttgttgtaaagaacaagagccaaaaacatatatgtcttgtcattggcagag-tttagaaatttccgtgtgaaaaggt 52511011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University