View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9419_low_20 (Length: 232)
Name: NF9419_low_20
Description: NF9419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9419_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 42 - 212
Target Start/End: Complemental strand, 15870056 - 15869886
Alignment:
| Q |
42 |
ctgaactcaatttaaaagttcataccgcattatcactgagcctggttgtggcatattgttcctaatatcttgttgttctgtatttgttgcaggcgaaaaa |
141 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15870056 |
ctgaactcaatttaaaagttcatactgcattatcactgagcctggttgtggcatattgttcctaatatcttgttgttctgtatttgttgcaggcgaaaaa |
15869957 |
T |
|
| Q |
142 |
catcccaagctggctgttgtcttaacaaatagggctcttatgtataagcgttttatggagaaggaacattc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15869956 |
catcccaagctggctgttgtcttaacaaatagggctcttatgtataaacgttttatggagaaggaacattc |
15869886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 192
Target Start/End: Original strand, 22796961 - 22797136
Alignment:
| Q |
17 |
tattcttttgatatgttactgttgcctgaactcaatttaaaagttcataccgcattatcactgagcctggttgtggcatattgttcctaatatcttgttg |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22796961 |
tattcttttgatctgttactgttgcctgaactcaatttaaaagttcatgctgcattattactgagcctggttgtggcatattgttcctaatatcttgttg |
22797060 |
T |
|
| Q |
117 |
ttctgtatttgttgcaggcgaaaaacatcccaagctggctgttgtcttaacaaatagggctcttatgtataagcgt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
22797061 |
ttctgtatttgttgcaggcgaaaaacatcccaagctgggtgttgtcttaacaaatatggctcttatgtataggcgt |
22797136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University