View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9420_high_13 (Length: 249)
Name: NF9420_high_13
Description: NF9420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9420_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 35398644 - 35398887
Alignment:
| Q |
1 |
ttgtgaaatttcttttctttccgacaagtaacagctgtttctgttttgaattacaatgatgtttattactctttggaagttgttcactaaatatcgatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35398644 |
ttgtgaaatttcttttctttccgacaagtaacagttgtttctgttttgaattacaatgatgtttattactctttggaagttgttcactaaatatcgatac |
35398743 |
T |
 |
| Q |
101 |
gatgcataactgtgatgcacaaaggttgtaaattctgatttttgtcaattatgttttttctctatcccacacaagtgcataggctgtgctttgaatgcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35398744 |
gatgcataactgtgatgcacaaaggttgtaaattctgatttttgtcaattatgttttttctctatcccacacaagggcataggctgtgctttgaatgcat |
35398843 |
T |
 |
| Q |
201 |
gacaatagattaaataactagttctacttctatggccctttgct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35398844 |
gacaatagattaaataactagttctacttctatggctctttgct |
35398887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 11375562 - 11375626
Alignment:
| Q |
1 |
ttgtgaaatttcttttctttccgacaagtaacagctgtttctgttttgaattacaatgatgtttat |
66 |
Q |
| |
|
||||||||||||||| ||||| |||||||||| |||||| || ||||||||| | |||||||||| |
|
|
| T |
11375562 |
ttgtgaaatttctttcctttctaacaagtaacaactgtttttg-tttgaattatattgatgtttat |
11375626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University