View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9420_low_23 (Length: 314)
Name: NF9420_low_23
Description: NF9420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9420_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 2569795 - 2569616
Alignment:
| Q |
15 |
acctgtgtgaattgaggtgtatgtgaattaagttcttgtgtgtaaatttatgaacaaaattgtcataacctcgtttataaacacatccacctataatacg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2569795 |
acctgtgtgaattgaggtgtatgtgaattaagttcttgtgtgtaaatttatgaacaaaattgtcataacctcgtttataaacatatccacctataatacg |
2569696 |
T |
|
| Q |
115 |
tcggaaaaaattatagcacaaaatgtgcaacaacnnnnnnntggaacgctaaaaatgggtatgcagaatgggttcgaattt |
195 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2569695 |
tcgga-aaaattatagcacaaaatgtgcaacaacaaagaaatggaacgctaaaaatgggtatgcagaatgggttcgaattt |
2569616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 267 - 309
Target Start/End: Complemental strand, 2569543 - 2569501
Alignment:
| Q |
267 |
cagtgcaaatattcattatgtctttttggagtttgttaagaaa |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2569543 |
cagtgcaaatattcattatgtctttttggagtttgttaagaaa |
2569501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University