View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9420_low_33 (Length: 252)
Name: NF9420_low_33
Description: NF9420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9420_low_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 11312499 - 11312258
Alignment:
| Q |
1 |
ccacagttcaaagggagaaaagccacgtcaaatcaacgagagtaaaagtgcttgtcaaatttgcataaaattgaatcatgaagctgttgattgctggtac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
11312499 |
ccacagttcaaagggagaaaagccacgtcaaaacaacgagagtaaaagtgcttgtcaaatttgcagaaaaccgaatcatgaagctgttgattgctggtac |
11312400 |
T |
 |
| Q |
101 |
aggtatgattattcttatcagtctgaagattttccccaggcacttgctgctcttgctctaaatgacacaaaggaccagtccttcattgtagattctggag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11312399 |
aggtatgattattcttatcagtctgaagattttccccaggcacttgctgctcttgctctaaatgacacaaaggaccagtccttcattgtagattctggag |
11312300 |
T |
 |
| Q |
201 |
ctacatcccacatgatcaatgatgcaggtaatttatcctatg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11312299 |
ctacatcccacatgatcaatgatgcaggtaatttatcctatg |
11312258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University