View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9420_low_34 (Length: 251)
Name: NF9420_low_34
Description: NF9420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9420_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 206
Target Start/End: Original strand, 480198 - 480392
Alignment:
| Q |
12 |
gcagagaacataacttcaaagtcaatcatggcaagactctctagtaatgatgagaattggttgcttggatgtctttgtcttttaggaaactgtgttgctt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
480198 |
gcagagaacataacttcaaagtcaatcatggcaagactctctagtaatgatgagaattggttgcttggatgtctttgtcttttaggaaactgtgttgctt |
480297 |
T |
 |
| Q |
112 |
ggtcaatttggctcattttgcaggtatagtatgttatttcaatatcaaaacacatatcatatatatgcgttaaggttttggatcaacatgtaata |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
480298 |
ggtcaatttggctcattttgcaggtatagtatgttatttcaatatcaaaacacatatcatatatatgcgttaaggttttggatcaacatgtaata |
480392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 59 - 138
Target Start/End: Original strand, 474898 - 474977
Alignment:
| Q |
59 |
tgatgagaattggttgcttggatgtctttgtcttttaggaaactgtgttgcttggtcaatttggctcattttgcaggtat |
138 |
Q |
| |
|
|||||| | |||||||||||||||| | | |||||| |||| ||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
474898 |
tgatgatagttggttgcttggatgtgtgtatcttttgggaagtagtgttgcctggtcactttggctcattttgcaggtat |
474977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 59 - 138
Target Start/End: Original strand, 467864 - 467943
Alignment:
| Q |
59 |
tgatgagaattggttgcttggatgtctttgtcttttaggaaactgtgttgcttggtcaatttggctcattttgcaggtat |
138 |
Q |
| |
|
||||||||||||||||||||||||||| | |||| | ||| | |||||||||| ||||| |||||||||||||||| |
|
|
| T |
467864 |
tgatgagaattggttgcttggatgtctgtctcttctcggatgcactgttgcttggggaatttttctcattttgcaggtat |
467943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 59 - 138
Target Start/End: Complemental strand, 27491479 - 27491400
Alignment:
| Q |
59 |
tgatgagaattggttgcttggatgtctttgtcttttaggaaactgtgttgcttggtcaatttggctcattttgcaggtat |
138 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||| ||||||||| |||||| ||||||| ||||||||||||| |
|
|
| T |
27491479 |
tgatgagaattggttgcttggatgtttggttctttttggaagctgtgttgcctggtcagtttggcttattttgcaggtat |
27491400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University