View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9420_low_43 (Length: 219)
Name: NF9420_low_43
Description: NF9420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9420_low_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 16 - 207
Target Start/End: Complemental strand, 43134697 - 43134507
Alignment:
| Q |
16 |
caaaatatacgaaacccaaatcccaaacactttgttctttcttattagaagaggtaattgtgacttgttaggttttactggtagttacaagcttatacca |
115 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43134697 |
caaaatatacgaaacacaaatcccaaactctttgttctttcttattagaagaggtagttgtgacttgttaggttttactagtagttacaagcttatacca |
43134598 |
T |
|
| Q |
116 |
ttttggagaataacgtgttggtgaccgagtcccacatcgatgagaagaaggaacttgtaccaaaggttttagttataaaatacaatacatct |
207 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
43134597 |
ttttggagaataatgtgttggtgactgagtcccacatcgacgagaagaaggaacttgtatcaaagg-tttagttataaaatacaatacatct |
43134507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University