View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9420_low_46 (Length: 202)
Name: NF9420_low_46
Description: NF9420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9420_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 22 - 190
Target Start/End: Original strand, 22339353 - 22339521
Alignment:
| Q |
22 |
acgcgtaacaggcgtcaaggggtgacggtctgcccgtcagcctgttgttgacttgcttctctgatttgtttacttggtgctgtcggcagggagcatgacg |
121 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22339353 |
acgcataacgggcgtcaaggggtgacggtctgcccgtcagcctgttgttgacttgcttctctgatttgttcacttggtgctgtcggcagggagcatgacg |
22339452 |
T |
|
| Q |
122 |
cccgccgtgctggggtggaggtgggggtggccgcgtcaagacaagttgggatttgtattttcttccttt |
190 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22339453 |
cccgtcgtgctggggtggaggtgggggtggccgcgtcaagacaagctgggatttgtattttcttccttt |
22339521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University