View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9421_high_19 (Length: 238)
Name: NF9421_high_19
Description: NF9421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9421_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 1369279 - 1369502
Alignment:
| Q |
1 |
tgcagagtggctggctggagtacctttctattaattaaatttcgcgtttatagaagtatagttcgtctttaaatactacgactatatccaacaagtgtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1369279 |
tgcagagtggctggctggagtacctttctattaattaaatttcgggtttatagaagtatagttcgtgtttaaatactacgactatatccaacaagtgtaa |
1369378 |
T |
|
| Q |
101 |
attgcaaaccaatgatttttcaattaactaacagtctaacacaaaatgattggaaatccagcaattttcattggaatatgcaagtacaaattttctcata |
200 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1369379 |
attgcaaaccaataatttttcaattaaccaacagtctaacacaaaatgattggaaatccagcaattttcattggaatatgtaagtacaaattttctcata |
1369478 |
T |
|
| Q |
201 |
ttttgttacctgacagtatggttt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1369479 |
ttttgttacctgacagtatggttt |
1369502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University