View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9421_low_10 (Length: 416)
Name: NF9421_low_10
Description: NF9421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9421_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 187 - 409
Target Start/End: Complemental strand, 22313409 - 22313187
Alignment:
| Q |
187 |
atcattccatcagaagaattaaaacaaatttgtttaaaagaaattgatgagtttctacatccaaatggaaaagcattagctcattatgaatgcatgccga |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22313409 |
atcattccatcagaagaattaaaacaaatttgtttaaaagaaattgatgagtttctacatccaaatggaaaagcattagctcattatgaatgcatgccga |
22313310 |
T |
|
| Q |
287 |
atataatagatgcctcttcacatttatacgataatttattgttggttaacgagttatcatatgactgcgatgagatgttggtcaatcatatggcgacatt |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22313309 |
atataatagatgcctcttcacatttatacgataatttgttgttggttaacgagttatcatatgactgcgatgagatgttggtcagtcatatggcgacatt |
22313210 |
T |
|
| Q |
387 |
gtccgtgctgttgagaataatct |
409 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
22313209 |
gtcggtgctgttgagaataatct |
22313187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 17 - 113
Target Start/End: Complemental strand, 22313570 - 22313474
Alignment:
| Q |
17 |
ctttgaaggtctgggagagtacttgagagaccttagcaaatggaattttgtatgatagacgtcttgcgttgaaattaccaggtttgtggtcatattc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| || |||||||||| ||||| |
|
|
| T |
22313570 |
ctttgaaggtctgggagagtacttgagagaccttagcaaatggaattttgtatgatagacatcatgcgttgaaattatcatgtttgtggtcgtattc |
22313474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University