View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9421_low_18 (Length: 350)
Name: NF9421_low_18
Description: NF9421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9421_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-169; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 18 - 345
Target Start/End: Original strand, 32863515 - 32863841
Alignment:
| Q |
18 |
ggctggtgttgttgttgtactcaaaaccgtaaggcaaagttgtgtgtaggagtgtgagatggcaagtggtagcagaccgaatcctcttgctgttgggcgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32863515 |
ggctggtgttgttgttgtactcaaaaccctaaggcaaagttctgtgtaggagtgtgagatggcaagtggtagcagaccgaatcctcttgctgttgggcgt |
32863614 |
T |
 |
| Q |
118 |
gtaataggggatgtattagacccctttgaaagtactattcctctcttaatcacctatggtaataggactgttaccaatggtggtgagcttaaaccttccc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32863615 |
gtaataggggatgtattagacccctttgaaagtactattcctctcttagtcacctatggtaataggactgttaccaatggtggtgagcttaaaccttccc |
32863714 |
T |
 |
| Q |
218 |
aagttgctaatcaaccccaagtgattattggcgtaaatgacccaacagccctctacaccctggtaattgcattaggtagttagcattgtttatatactta |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32863715 |
aagttgctaatcaaccccaagtgattattggcgtaaatgacccaacagccctctacaccctggtaattgcattaggtagtt-gcattgtttatatactta |
32863813 |
T |
 |
| Q |
318 |
gtatattatcaccatatcctttgcttct |
345 |
Q |
| |
|
||||||||||||||||| ||||| |||| |
|
|
| T |
32863814 |
gtatattatcaccatattctttgtttct |
32863841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 96 - 233
Target Start/End: Original strand, 32843604 - 32843741
Alignment:
| Q |
96 |
gaatcctcttgctgttgggcgtgtaataggggatgtattagacccctttgaaagtactattcctctcttaatcacctatggtaataggactgttaccaat |
195 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||||| ||||| | ||||||| | | |||||||| | | ||||||||||||||| ||| | ||| |
|
|
| T |
32843604 |
gaatccactagctgtagggcgtgtaataggggatgtaatagactcatttgaaaattccattcctcttcgagtgacctatggtaatagggatgtgaataat |
32843703 |
T |
 |
| Q |
196 |
ggtggtgagcttaaaccttcccaagttgctaatcaacc |
233 |
Q |
| |
|
||| ||||||| |||||||| ||| ||| |||||||| |
|
|
| T |
32843704 |
ggttgtgagctcaaaccttctcaaattggaaatcaacc |
32843741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University