View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9421_low_21 (Length: 335)
Name: NF9421_low_21
Description: NF9421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9421_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 16 - 319
Target Start/End: Complemental strand, 15288911 - 15288608
Alignment:
| Q |
16 |
tgtgactatgagttattgactttgttgactagcttgtaattttgactcttcaatttaaagctagcatttttgttgtttgagaagaagattaatggctccg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15288911 |
tgtgactatgagttattgactttgttgactagcttgtaattttgactcttcaatttaaagctagcatttttcttgtttgagaagaagattaatggctccg |
15288812 |
T |
 |
| Q |
116 |
ttgaagatccaaccgattgacatagattcagagaaagccactacggaactggttcgaaatgaaccagtttcgaaatggaggttgaagaggtttttcgctt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15288811 |
ttgaagatccaaccgattgacatagattcagagaaagccactacggaactggttcgaaatgaaccagtttcgaagtggaggttgaagaggtttttcgctt |
15288712 |
T |
 |
| Q |
216 |
tcgagaaaccttttccgaagaacaataccactaaagatggtgctggtggagttgctgagttggaaccaagctctgtttgcttggcgaaaatggttcagag |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
15288711 |
tcgagaaaccttttccgaagaacaataccactaaagatggtgctggtggagttgctgagttggaaccaagctctgtttgcttggcgaaaatggttcaaag |
15288612 |
T |
 |
| Q |
316 |
tttc |
319 |
Q |
| |
|
|||| |
|
|
| T |
15288611 |
tttc |
15288608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University