View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9421_low_34 (Length: 273)
Name: NF9421_low_34
Description: NF9421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9421_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 262
Target Start/End: Original strand, 41559372 - 41559616
Alignment:
| Q |
18 |
ggtacgtgatgagatcacactcaatcatggaaaatgcactattttatgatgtgtacatttgcataaaacaaattatcgccactcacactgtgaatccctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41559372 |
ggtacgtgatgagatcacactcaatcatggaaaatgcactattttatgatgtgtacatttgcataaaacaaattatcgccactcacactgtgaatccctg |
41559471 |
T |
|
| Q |
118 |
gccctgatgcatctaaaagttatgaacatcaaaggatagtacatattggttttttggaattctgagaccttctgttgttttcacaaatttcattgatatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41559472 |
gccctgatgcatctaaaagttatgaacatcaaaggatagtacatattggttttttggaattctgagaccttctgttgttttcacaaatttcattgatatc |
41559571 |
T |
|
| Q |
218 |
aaaatgatgtcaatgatgaaatatgattcttcctagtctctgctt |
262 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41559572 |
aaaataatgtcaatgatgaaatatgattcttcctagtctgtgctt |
41559616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 55 - 144
Target Start/End: Original strand, 41543327 - 41543416
Alignment:
| Q |
55 |
actattttatgatgtgtacatttgcataaaacaaattatcgccactcacactgtgaatccctggccctgatgcatctaaaagttatgaac |
144 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| | | ||| |||||||||||||||||||||||| |||| ||||| |
|
|
| T |
41543327 |
actattttatgatgtgtacatttgtataaaacaaattatcgccagtgatgctgcaaatccctggccctgatgcatctaagagttctgaac |
41543416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 177 - 246
Target Start/End: Original strand, 41543417 - 41543486
Alignment:
| Q |
177 |
ttctgagaccttctgttgttttcacaaatttcattgatatcaaaatgatgtcaatgatgaaatatgattc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||| ||||||||||| |
|
|
| T |
41543417 |
ttctgagaccttctgttgttttcacaaacttcattgatatcataatgatgtcagtgataaaatatgattc |
41543486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 18 - 57
Target Start/End: Original strand, 41543229 - 41543268
Alignment:
| Q |
18 |
ggtacgtgatgagatcacactcaatcatggaaaatgcact |
57 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
41543229 |
ggtacttgatgagatcacactcaatcatggaatatgcact |
41543268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University